SGN Marker TG272

SGN-M210

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AATTATAACTTTTCTTTCTTTTTAATCAATCATGGATTTTGCCCCCTCTACCAAGTCTGATTTAGTTAGTGTATATACATGTTTTCCTCT
GTTCGTGACTTTCACGGGGGCTATTCTTGGATGGCTTCTCAAGGAAAAAGAATGTCTATGTCAATGTCTCAATTCTCGTATTCTTTATAA
ATCAAAGTGTCAATTCGGTGGCTGGGTCACGAATAAATAGAGTAGAAGTATGCTAAACATCCCTGTGTTACAGTAGTCCCACTCTCAAGT
CAAAAAAGACACTGAAAGCCGTGCACTGAAGAGTTAAGCTTGTAAAGAGGCTTCAATGATCCTGGGTTATTTTGAAGTATCATTGTTTAC
TGGAGGCAGAGGGAAGGAAAAGATGTGTAATCCTGAAATAATTTTGTTTCCATCTCATGTACTGGCTCTGGTTCAGTGTGGTTCTCTGAT
GCTATATGGTGCACCTAGTCTTATACTCATT
Reverse sequence
ACCTCAGTTAGCAAAACAATGGCTCCAATATGCCTGACCCAACTCTAGAAAACTTCATTTGTCATCATTACAGCCTGAACAAGGAGTAGT
AGTATAGTGCGCCTAAATTCAGTTAATATGGAGTATAATTTTAGCTAAACACCACACAATTTAAGCCAATCCAAACAAACCATCAGCTGA
AGAACAGCGAGAGGGCAACCACCATTAATAACTCCCCAATGCCTCTCTCGTCGTCCAGAGTTTCATTAACACAAACTTTGATTTAGTACA
TGTAGTATCTTCCTGTTACATTTCTACTTAGTCACATTTCTATTTTAAAAGTATACCTAATAAGTTTGATAATGCATATTTTCACTCTTA
GAATTCATAGTTAGCAAATAGATATAGCAATTGTTCGGAGCTCATTAATAATCATCAGGTGTTGTAACTGAGAGCGTGTTTGTCTTTCTT
TTGTTCATAGTTTGATATTCTGAACAGTAAA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53529)
Chromosome
4
Position
63.16 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53246)
Chromosome
4
Position
45.08 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Pepper-AC99   
Map version
34 (location: 8587)
Chromosome
4
Position
31.16 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Pepper-FAO3   
Map version
31 (location: 8586)
Chromosome
7
Position
51.66 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-FAO3

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8585)
Chromosome
4
Position
50.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8589)
Chromosome
4
Position
25.10 cM
Confidence
I(LOD2)
Protocol
RFLP
Subscript
B


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8588)
Chromosome
4
Position
54.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG272 was used as an overgo probe on plate 10 [well E3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCTCATGTACTGGCTCTGGTTCAG
B sequence
GCATCAGAGAACCACACTGAACCA
AB sequence
TCTCATGTACTGGCTCTGGTTCAGTGTGGT
Marker sequence
AATTATAACTTTTCTTTCTTTTTAATCAATCATGGATTTTGCCCCCTCTA
CCAAGTCTGATTTAGTTAGTGTATATACATGTTTTCCTCTGTTCGTGACT
TTCACGGGGGCTATTCTTGGATGGCTTCTCAAGGAAAAAGAATGTCTATG
TCAATGTCTCAATTCTCGTATTCTTTATAAATCAAAGTGTCAATTCGGTG
GCTGGGTCACGAATAAATAGAGTAGAAGTATGCTAAACATCCCTGTGTTA
CAGTAGTCCCACTCTCAAGTCAAAAAAGACACTGAAAGCCGTGCACTGAA
GAGTTAAGCTTGTAAAGAGGCTTCAATGATCCTGGGTTATTTTGAAGTAT
CATTGTTTACTGGAGGCAGAGGGAAGGAAAAGATGTGTAATCCTGAAATA
ATTTTGTTTCCATCTCATGTACTGGCTCTGGTTCAGTGTGGTTCTCTGAT
GCTATATGGTGCACCTAGTCTTATACTCATT
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG272  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D210 marker 210
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)