SGN Marker T1566

SGN-M2100
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.02.01
Tomato EST read: TPTBC56TH
Arabidopsis best BAC match: AC011664.8
Arabidopsis position: 3.0036000
Arabidopsis identities: 0.800
Best GenBank protein hit: AAF03458.1
Evalue: 3.4e-89
Identities: 0.790
Description: putative sulfite oxidase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39685)
Chromosome
2
Position
141.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14090
Forward primer (5'-3')
CAGCTTCGCAACCAGCAGCT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CACCACCAGATTCGGAGATT
Enzymes
  
Accessions and product sizes
Approximate temperature
61°C
  
Overgo hybridization and physical mapping 
T1566 was used as an overgo probe on plate 11 [well D8]

Plausible BAC Matches:   P030D23,   P274B06,   P122A16,   P018G22,   P041K16,   P270H24,   P258N07

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ACTCACACACACACACACACCTAG
B sequence
CTTCACAGTAGTCCTGCTAGGTGT
AB sequence
ACTCACACACACACACACACCTAGCAGGAC
Marker sequence
GCCAATATTTGTACAAATCTTCCTCATCTCCCTCGCACTCACACACACAC
ACACACCTAGCAGGACTACTGTGAAGCCGGCGGCAAAGGAAACTGAGAAA
ATGCCTGGGATTAAAGGGCCTTCCGATTATTCGCGAGAACCCCCTCGCCA
TCCTTCTCTTAAAGTTAATGCCAAGGAACCCTTTAATGCTGAGCCAACTC
GTTCAGCTCTGATTTCATCTTATGTCACTCCTGTTGATTTCTTTTACAAG
AGAAACCACGGACCCATACCAGTAGTCGATGACATAGAGAGGTATTCCGT
TTCTCTGAGTGGTCTTATAAAAAATTCCAAAGACTTGTTTATGAAGGATA
TTTGTAAGCTTCCAAAATATACGGTTACTGCCACTTTACAGTGTGCTGGT
AACAGAAGAACTGCTATGAGTAAGAGTCCAACGGTGAAAGGAGTTGGTTG
GGATATTGCTGCTTTAGGAAATGCTGTTTGGGGTGGAGCCAAATTGGCAG
ATGTTCTAGAATTAGTTGGAATACCTTATTTGGCAAGTATCACACAATCT
GGAGGAAAACATGTGGAATTTGTGAGCATTGACAAGTGTAAGGAGGAAGA
TGGAGGTCCTTATAAAGCATCAATTCCATTGAGTCAGGCTACAAACCCTG
NAGCTGATGTTCTGCTCGCTTATGAGATGAATGGAGAGCC
Genomic location of T1566  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2100 marker 2100
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)