SGN Marker solcap_snp_sl_25427

SGN-M21013

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71656)
Chromosome
2
Position
32.74 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57344)
Chromosome
2
Position
35.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTAGGGTTTTGACCATGAGAGAGAGGAGAGGGAGAGAAGGGGCGGATCTG
  
3' flanking region
CGGATTTATGTGTAAGCGTCACCAGTTAACAGAGATGGAGAACGCGTGAC
SNP nucleotide
AG
SNPdb format
GTAGGGTTTTGACCATGAGAGAGAGGAGAGGGAGAGAAGGGGCGGATCTG[A/G]
CGGATTTATGTGTAAGCGTCACCAGTTAACAGAGATGGAGAACGCGTGAC
  
Genomic location of solcap_snp_sl_25427  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21013 marker 21013
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)