SGN Marker T1570

SGN-M2103
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBC68TH
Arabidopsis best BAC match: AC003672.2
Arabidopsis position: 2.2400000
Arabidopsis identities: 0.776
Best GenBank protein hit: AAC27473.1
Evalue: 7.4e-29
Identities: 0.776
Description: putative heterogeneous nuclear ribonucleoprotein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39686)
Chromosome
10
Position
32.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1570 was used as an overgo probe on plate 16 [well E1]

Plausible BAC Matches:   P034L05,   P143K18,   P032F15,   P102L15

 Overgo Sequences

A sequence
TGAGAAAGACGGCTTCAGGTTCTG
B sequence
CCACCTCTTTTGGATCCAGAACCT
AB sequence
TGAGAAAGACGGCTTCAGGTTCTGGATCCA
Marker sequence
GCTTGAAACTATGCCTTCAAAATCAGTGAGAAAGACGGCTTCAGGTTCTG
GATCCAAAAGAGGTGGCCGTACACCTCGTGGTACGCCAAAGTCTCAGGCA
AAGCCTGTTAAGGTAGAGGAACCAATGGAAGTACAGGACAAAGATAAGGC
GGTGGAGGAGGTATCTGAAGAAAAGCCTGAGCTTAAAATCATGCAATCGG
AGCCTGAGGAACCGGCTGAAACTGCATTGAATGTGAATGCTGTGGGAAAG
GGGGCGGTTTCAGAGAAGAGTTAAAACAGTGTTTATTGATGGTCTTGCTG
TATCCTGGAACGAGGACCATGTGCGGGAGCTTCTTAAAGAATATGGAAAA
ATAAGAAAAGTTGAGCTTGCCAGAAATAGGCCTTCAGCCAAGAGAAAGGA
CTTTGGATTTGTCACCTTTGACACTCATGAGGCTGCAGTTACATGTGCTA
AAAGCATTAATAATGAGGAATTGGGTGAAGGAGATAACAAGGTTAAAGTA
AGGGCCAGACTATCGAGACCCCTGCATATGGGTAGAGGGAAATATGGTGG
ACGA
Genomic location of T1570  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2103 marker 2103
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)