SGN Marker solcap_snp_sl_25454

SGN-M21034

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71665)
Chromosome
2
Position
32.19 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68040)
Chromosome
2
Position
47.11 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64435)
Chromosome
2
Position
65.67 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57365)
Chromosome
2
Position
35.79 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGAGGAAACGTAACTGTTGGAAACACTACTTATATAGCAGATGAAGACTC
  
3' flanking region
GCAGGTGCTGCAAAATTTGTTTACTGGAAAGGGAACTGGGGAACCAGCAG
SNP nucleotide
AC
SNPdb format
GGAGGAAACGTAACTGTTGGAAACACTACTTATATAGCAGATGAAGACTC[A/C]
GCAGGTGCTGCAAAATTTGTTTACTGGAAAGGGAACTGGGGAACCAGCAG
  
Genomic location of solcap_snp_sl_25454  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21034 marker 21034
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)