SGN Marker T1571

SGN-M2104
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBC69TH
Arabidopsis best BAC match: AL021712.2
Arabidopsis position: 4.1150000
Arabidopsis identities: 0.542
Best GenBank protein hit: CAB79187.1
Evalue: 7.7e-21
Identities: 0.465
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39687)
Chromosome
4
Position
47.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1571 was used as an overgo probe on plate 9 [well D3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAACAACCACAGTCGGAACACTGC
B sequence
ATTAACGCCACCGTTGGCAGTGTT
AB sequence
TAACAACCACAGTCGGAACACTGCCAACGG
Marker sequence
TCCACTAAAAAGAACAAAAAGCATAAGCGACTGATCGGAGAAGAAACAAC
TCGCCGCCGAGTTAACACCGGTTCGCCGTCGTAAATGGATGGAGTAGGTG
CCCGTCTCGGCCGGTCATCAGCTAGGTACGCACCGACAACTGTATTTACT
GGTCCGGTTCGTAGGTGGAAGAAGAAATGGATCCAAGGAACACCGCCCAG
CTCCGGTAACAACCACAGTCGGAACACTGCCAACGGTGGCGTTAATGGCA
GTAACGTCTCTCATCTATTGCTTTTCAAGTGGATACCTATTACGGCGAGC
CAGAACAATAATGACAGTTCCTCCAAAGACGACGTCGTTTCTGTGGAGGA
ACCACCTAAACGCAAATTCAAGTACATTCCGGTACTAATCTTCCTAATTT
TACTTCTTTATGAACTTAAAATACTGGGTGTATGTATGTATATTTTTGCT
ATTACATTTAAGTATCCGGTATCCCGAACCTACCTGCCTGAATATTCCAA
ATTGACGCTGTGTATATCACTGTATTGTATATAACTGTAAACATACTTCA
ATATAGTGCAATTTG
Genomic location of T1571  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2104 marker 2104
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)