SGN Marker solcap_snp_sl_25475

SGN-M21043

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68046)
Chromosome
2
Position
46.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64441)
Chromosome
2
Position
64.99 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57374)
Chromosome
2
Position
35.69 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGGAAGGGGATGTTATAGATATTGATCCAAGGATCAGGCTGATGTATTC
  
3' flanking region
GCTAATGAGGGTGATATAGAAGGGATCAAGGAGCTTTTGGATTCGGGGAC
SNP nucleotide
AT
SNPdb format
GAGGAAGGGGATGTTATAGATATTGATCCAAGGATCAGGCTGATGTATTC[A/T]
GCTAATGAGGGTGATATAGAAGGGATCAAGGAGCTTTTGGATTCGGGGAC
  
Genomic location of solcap_snp_sl_25475  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21043 marker 21043
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)