SGN Marker T1576

SGN-M2107
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBD02TH
Arabidopsis best BAC match: AB008264.1
Arabidopsis position: 5.1350000
Arabidopsis identities: 0.724
Best GenBank protein hit: BAB09197.1
Evalue: 1.0e-21
Identities: 0.537
Description: similar to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39688)
Chromosome
4
Position
118.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1576 was used as an overgo probe on plate 6 [well D11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AACCCTCAAAACCCACATGCTTGC
B sequence
TCCTTTAGGATGTCCCGCAAGCAT
AB sequence
AACCCTCAAAACCCACATGCTTGCGGGACA
Marker sequence
GAGATTTTCCTGATATGACATCTGTTCAACCTTCCGTGTCTGTCAATGAT
GATGACAACTTTATTGAAGCTAAAGAAACTAAAAAGAGCCGCAAAAGATC
TGCAAAATCTAAGGGAGCAGGAGCAAAGGCCTCAGTGCCCACAGCTGCTT
CCGAGATGTCTGTTGCATCAAGTCCTATTGACAAAGTCAAAAGCTTGCGT
CAGGTACAACCTGACCAGGAAGTATTACCTGCTATACCATCTGGTCCTTC
GCTAGGAGATTTTGCTGTTTGGAAGGGTGAGTCTGCAAGTTCTGCTACTA
TTCCTGTTCCAGCATGGTCCACCGACTCTGGGAAACCCTCAAAACCCACA
TGCTTGCGGGACATCCTAAAGGAACAAGAAAAGAAGGTTACTTCTTGACA
GCAGCATATACCAGTGCCAACACAGAAATCTGTG
Genomic location of T1576  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2107 marker 2107
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)