SGN Marker solcap_snp_sl_25745

SGN-M21076

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71688)
Chromosome
9
Position
70.20 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68063)
Chromosome
9
Position
83.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57407)
Chromosome
9
Position
66.53 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GACTCAGATCATTCATAGAGATGTTAAGACAAGCAATGTGATGCTTGATT
  
3' flanking region
CAATTTCAACGCCCGGCTAGGCGATTTTGGTTTAGCTAGGTGGTTGGAAC
SNP nucleotide
AC
SNPdb format
GACTCAGATCATTCATAGAGATGTTAAGACAAGCAATGTGATGCTTGATT[A/C]
CAATTTCAACGCCCGGCTAGGCGATTTTGGTTTAGCTAGGTGGTTGGAAC
  
Genomic location of solcap_snp_sl_25745  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21076 marker 21076
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)