SGN Marker solcap_snp_sl_258

SGN-M21078

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71690)
Chromosome
5
Position
80.88 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68065)
Chromosome
5
Position
84.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64460)
Chromosome
5
Position
134.86 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57409)
Chromosome
5
Position
63.60 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTCCTTCACGGTCAACCTCCGCCGTACTCCGCCATATTCTTCCCGTCGT
  
3' flanking region
AGCGACTTCTCCCTGAATATCAACACTCAACCTAAGTTTCCGGTGAACAG
SNP nucleotide
TC
SNPdb format
CTTCCTTCACGGTCAACCTCCGCCGTACTCCGCCATATTCTTCCCGTCGT[T/C]
AGCGACTTCTCCCTGAATATCAACACTCAACCTAAGTTTCCGGTGAACAG
  
Genomic location of solcap_snp_sl_258  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21078 marker 21078
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)