SGN Marker T1577

SGN-M2108
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBD08TH
Arabidopsis best BAC match: AB025633.2
Arabidopsis position: 5.0410000
Arabidopsis identities: 0.700
Best GenBank protein hit: BAA97248.1
Evalue: 8.9e-37
Identities: 0.546
Description: contains similarity to unknown protein~gb|AAF27018.1~gene_id:MQM1.21 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49458)
Chromosome
10
Position
51.42 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47392)
Chromosome
10
Position
31.68 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39689)
Chromosome
10
Position
34.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1577 was used as an overgo probe on plate 1 [well F5]

Plausible BAC Matches:   P202K10,   P137F03,   P251D05,   P053L19

 Overgo Sequences

A sequence
GGACACGAATTGCACTATCCTTCG
B sequence
TCGGTAACGGTAGAGACGAAGGAT
AB sequence
GGACACGAATTGCACTATCCTTCGTCTCTA
Marker sequence
CTTTCTTCATCTATGGCCCAAAAAGAGAAGAAATCATCTCCGGGAATTCC
TTGGAGGACACGAATTGCACTATCCTTCGTCTCTACCGTTACCGATTATT
CTCGCCGTCAAAACGGCACCGTTAACCGCCGGCTACTCGGGATCTTTGGT
CTCAAAACTTCTGCCAATCCAAATCCAGTTAACGGCGTTAAATCCTACGA
GGTCACTGTAGATTCTTCTCGCGATCTCTGGTTTCGCCTCTTCATTCCAA
CTACCGATGAATCTCGGAATTTGAGTTCACTTCCGATCATCGTCTTCTTC
CACGGTGGCGGATTTGTGTATCTCAGCCCGGATACGAAGGCGTACGACGC
CGTTTGCCGTCGTTTCGCGAGGAAAACCCCGGCTGTTGTTGTCTCTGGTA
ATTATCGGCTTGCTCCGGAACACAAGTAT
Genomic location of T1577  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2108 marker 2108
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)