SGN Marker solcap_snp_sl_25829

SGN-M21080

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71692)
Chromosome
5
Position
49.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68066)
Chromosome
5
Position
56.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64461)
Chromosome
5
Position
69.55 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57411)
Chromosome
5
Position
59.40 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGAGTGTCCACATAAATAACATTTGCATCTGAAAGATCTTTTCTTGTTTG
  
3' flanking region
GCCAATGCATCTTTAAGCATATTGTTATAGTCCACAACTGCATTGTTGTA
SNP nucleotide
TG
SNPdb format
TGAGTGTCCACATAAATAACATTTGCATCTGAAAGATCTTTTCTTGTTTG[T/G]
GCCAATGCATCTTTAAGCATATTGTTATAGTCCACAACTGCATTGTTGTA
  
Genomic location of solcap_snp_sl_25829  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21080 marker 21080
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)