SGN Marker solcap_snp_sl_25857

SGN-M21086

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64463)
Chromosome
5
Position
102.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57417)
Chromosome
5
Position
61.85 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCCATAAGTCACATTATGGAGCCTCTAAAGGAGAACACGGGGAAGACAT
  
3' flanking region
TCATGAGATTCATAGCCGATGGTAATTTGCCATTTGGGTAATGAGCATTA
SNP nucleotide
AG
SNPdb format
TTCCATAAGTCACATTATGGAGCCTCTAAAGGAGAACACGGGGAAGACAT[A/G]
TCATGAGATTCATAGCCGATGGTAATTTGCCATTTGGGTAATGAGCATTA
  
Genomic location of solcap_snp_sl_25857  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21086 marker 21086
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)