SGN Marker T1581

SGN-M2109
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.01
Tomato EST read: TPTBD78TH
Arabidopsis best BAC match: AL021635.1
Arabidopsis position: 4.1170000
Arabidopsis identities: 0.816
Best GenBank protein hit: CAB79222.1
Evalue: 1.9e-66
Identities: 0.772
Description: HSP associated protein like [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49459)
Chromosome
8
Position
60.04 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47393)
Chromosome
8
Position
80.14 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39690)
Chromosome
8
Position
63.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1581 was used as an overgo probe on plate 12 [well E7]

Plausible BAC Matches:   P060C12,   P233O14,   P047F11,   P302I09,   P171F16,   P193M06,   P029D02,   P063N19,   P184C04,   P148K12,   P309O02,   P089B17,   P068B16,   P101O15

 Overgo Sequences

A sequence
CTGTGGAACCTGACAATGATGAGC
B sequence
TCTCCCATCTTCTGTGGCTCATCA
AB sequence
CTGTGGAACCTGACAATGATGAGCCACAGA
Marker sequence
GATTGAATCTGATATTGAGCTTGATGAGAGTGACACTGTGGAACCTGACA
ATGATGAGCCACAGAAGATGGGAGACCCTTCTGTGGAGGTGACTGAAGAA
AGCCGTGATGCTTCTCAGGAGTCCAAAGCTCAGGCCATGGAAGCAATTTC
TGAAGGTAAGCTAGAAGATGCAATTGAGCATCTTACAAAGGCAGTTCTCC
TCAATCCTAAATCAGCAATTATGTATGCTACTAGAGCTAGTGTTTATATC
AAGATGAAGAAGCCAAACGCTGCCATACGAGATGCAACTGCAGCGTTGGA
GTTAAATCCAGATTCTGCTAAAGGTTACAAATCTCGTGGCATTGCCAGAG
CCATGCTGGGACAGTGGGAGGCAGCTGCTAAGGATCTTCATGTGGCTTCA
AAGCTGGACTATGATGAGGAAATAAGTGCTGTGCTTAAGAAGGTTGAGCC
AAATGCACATAGAATTGAAGAACACCGCAGGAAATATGATAGGTTGCGCA
AAGAACGAGAAGATAGAAAGATTGAGCGTGAGAGACA
Genomic location of T1581  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2109 marker 2109
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)