SGN Marker TG352

SGN-M211

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TTTCAGTGGAGGGCTTTTGATGTTCTGGGAATTATTTTTGAGGGATGTCTCATGTAGTTTGTTGTACTATCGTATATTTATTTCATCCCG
TGTTGGAGTAGTACAAATGTTTAATTCTATTACTAGATAGTTCAAGTTTCTAGAGTATCAACCATTTATTAGTAGTTGCAAGATCTACTT
GAAGCTAGAGGTGGATGCTTGCATTATTAGCTGGAGTAATGGATTTGGTGATTATGATTTATCTCTTCTTTTAGCAGGACATATGTAATT
AACTAAATATCATGTGAATTGACTTCAGGGTGCCATATTTATTACCTGGCACTACAGCACAACCGCATAAGTCATATCCGGCAGTTTTTC
ATCTTTTAGCTTCAAGTTGCTAGATTTTATTTGTGTATAATATTGTTTCGTTCTTCTTCCTTGATGCTACTGGACATTAACTACGTAGAA
T
Reverse sequence
CTCCATGACAGTCGGGTATGCATCCTTGAGGTCGATAACAGCAATACCCTCAGGGAATTTTCTTATCAAGATAAGTAGTTGCTCTTTATT
TTTCAGAGCATGTTTCGACTGTTGACAAATAATAAGTGAATTTATGTTACTAAAGAGTAAAGACACACAGATTCAGAGTTGATTACAAAT
GACTTAAAGACAGAGGAGTACAATTAAGAAGACCTTAATTTACCTTATAAGAAAAGCGATTGCCATCATAATATACTTTGACGTTTTTCC
TCAAACTGTCAAACACAGGTTTATTGCCAATTAAATCAACATAACATGCTTCATTGATCTGTTCTGGTGTGAAAGCTTGCCTTGTCTGCA
TGTATGGAAATTAATTAGTTATCAATATTACAAGTACTACGACTACAGAATATGTCACAGTTCCCTATAAGATAACAGGACAAGACACTA
TTAATCAAGGTGGAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1446401.6e-56110 (23.7% of RFLP seq)-
SGN-U1446407.4e-71134 (28.8% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 40009)
Chromosome
6
Position
33.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8590)
Chromosome
6
Position
19.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8591)
Chromosome
6
Position
25.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8594)
Chromosome
6
Position
18.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG352 was used as an overgo probe on plate 2 [well C11]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P294H15,   P107O24,   P119O17,   P313A09,   P114G08

 Overgo Sequences

A sequence
TGGCACTACAGCACAACCGCATAA
B sequence
AACTGCCGGATATGACTTATGCGG
AB sequence
TGGCACTACAGCACAACCGCATAAGTCATA
Marker sequence
TTTCAGTGGAGGGCTTTTGATGTTCTGGGAATTATTTTTGAGGGATGTCT
CATGTAGTTTGTTGTACTATCGTATATTTATTTCATCCCGTGTTGGAGTA
GTACAAATGTTTAATTCTATTACTAGATAGTTCAAGTTTCTAGAGTATCA
ACCATTTATTAGTAGTTGCAAGATCTACTTGAAGCTAGAGGTGGATGCTT
GCATTATTAGCTGGAGTAATGGATTTGGTGATTATGATTTATCTCTTCTT
TTAGCAGGACATATGTAATTAACTAAATATCATGTGAATTGACTTCAGGG
TGCCATATTTATTACCTGGCACTACAGCACAACCGCATAAGTCATATCCG
GCAGTTTTTCATCTTTTAGCTTCAAGTTGCTAGATTTTATTTGTGTATAA
TATTGTTTCGTTCTTCTTCCTTGATGCTACTGGACATTAACTACGTAGAA
T
Genomic location of TG352  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D211 marker 211
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)