SGN Marker T1582

SGN-M2110
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBD81TH
Arabidopsis best BAC match: AL035353.1
Arabidopsis position: 4.1470000
Arabidopsis identities: 0.694
Best GenBank protein hit: CAB81462.1
Evalue: 1.6e-30
Identities: 0.694
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49460)
Chromosome
9
Position
56.79 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47394)
Chromosome
9
Position
53.14 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39691)
Chromosome
9
Position
51.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1582 was used as an overgo probe on plate 6 [well B2]

Plausible BAC Matches:   P293J24,   P318P10,   P040G14,   P207P03,   P282L09,   P220D03,   P305G12,   P047I08,   P281I06,   P167H14,   P043M11,   P019I06,   P203A02,   P262D13,   P202I15,   P140K11,   P069I09,   P285G06,   P324L24,   P022N17,   P113H12,   P330J17,   P240I20

 Overgo Sequences

A sequence
CCGTCAATTCTCCCAACTTCCATC
B sequence
GACCGTTTAGCGGTAAGATGGAAG
AB sequence
CCGTCAATTCTCCCAACTTCCATCTTACCG
Marker sequence
GTTGCTCAGCCATGGCTACGGCGGCGCTGTTCTCCTATATTACCGTCAAT
TCTCCCAACTTCCATCTTACCGCTAAACGGTCCGAATTCTCCCGCCAATT
GAAATATGGTGGGAAATACTACTCCGGCTTCACTGACATCTCCAGTTCCA
GACGCAAACCGAAATCGCTCTCCGTAGTTTGTAACAATTCGAGTCCTTCT
TCTTCTGATATAAGTTCTACGGCCAAGATAAGAAGTGAAGTTCTTTCTCC
CTTTCGGTCTGTTCGGATGTTCTTCTATGTTGCTTTTATTGCAAGCGCTG
GTCTTGGAGGTCTTATTGCCTCTACACGACTAATTGCTGCATTGGCCAAT
TCATCAAGAGGTGCTGAAGTTCCTGAGATCCTAAAAGGTCTCGGTATAGA
TCTCAGTGCAGTCTCCGGATGTGCTTTTCTGTATTATAGAGAGAATAAAG
CGAAAAATGCTCAGGTAGCACAATTAGCAAGAGAGGAAAATCTCTCAAAT
CTTAAGCTCCGTGTGGATGATAAGAAAAT
Genomic location of T1582  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2110 marker 2110
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)