SGN Marker solcap_snp_sl_25951

SGN-M21107

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57438)
Chromosome
1
Position
72.66 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTTTGGCAATGAGAACAGCAGCCACTTCATCTTGAATACTTTGAAGATAT
  
3' flanking region
ATGAAACACTGTCCACAGTAGGCAACCGAACAGAGATGACTCTGGTGATA
SNP nucleotide
AG
SNPdb format
TTTTGGCAATGAGAACAGCAGCCACTTCATCTTGAATACTTTGAAGATAT[A/G]
ATGAAACACTGTCCACAGTAGGCAACCGAACAGAGATGACTCTGGTGATA
  
Genomic location of solcap_snp_sl_25951  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21107 marker 21107
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)