SGN Marker solcap_snp_sl_25953

SGN-M21109

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64468)
Chromosome
1
Position
72.14 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57440)
Chromosome
1
Position
72.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTGCATATAAAATGCAGTAGGCCACTCGGGCAAGCACACCTGGGCTTGC
  
3' flanking region
TAGCGTCCCTTAGTGCGAGTTCTGGTTGGCCATTCATCATGTAGGAAAGG
SNP nucleotide
AG
SNPdb format
CCTGCATATAAAATGCAGTAGGCCACTCGGGCAAGCACACCTGGGCTTGC[A/G]
TAGCGTCCCTTAGTGCGAGTTCTGGTTGGCCATTCATCATGTAGGAAAGG
  
Genomic location of solcap_snp_sl_25953  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21109 marker 21109
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)