SGN Marker T1584

SGN-M2112
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBD96TH
Arabidopsis best BAC match: AL132975.1
Arabidopsis position: 3.1193000
Arabidopsis identities: 0.846
Best GenBank protein hit: BAB03604.1
Evalue: 4.0e-36
Identities: 0.934
Description: putative glycoprotein [Oryza sativa]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49461)
Chromosome
5
Position
63.55 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47395)
Chromosome
5
Position
124.26 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39693)
Chromosome
5
Position
108.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1584 was used as an overgo probe on plate 11 [well D9]

Plausible BAC Matches:   P002J20,   P102L21,   P246L20,   P024O02,   P131D04

 Overgo Sequences

A sequence
CTTCTTCAGACGACGATGCTTTCC
B sequence
GACTAACTGGGCTCTTGGAAAGCA
AB sequence
CTTCTTCAGACGACGATGCTTTCCAAGAGC
Marker sequence
AGATTAAACAAAGATGGTTCTTGAAGCCATCACAAAGAAGTGGGAACTAC
AAATATCATGGAAGTCAAATCATCTGGTATAAAAAGAGGCAAGACATGGA
ACAGTAATACAAAAGAAAAATCTGAGTATTGCTTCCTTTAGTGAGAAACA
TAAACCTTCAAAAGTTTGCAGGTTCACAGAAAATGATCAACTAAATAAAT
AAGTCTTGGGCTTTTTCTCACATCGTCGAGGAAATGGTCTACAGGAAAGG
AGGCAATATCACCCATCGTCGAGGATATTTTGGTCTTCCTTCCTTTCCAT
CAAAGAGCTTCTTCAGACGACGATGCTTTCCAAGAGCCCAGTTAGTCATA
ATGCTAGCAGCAACAATCATGAAGATATAGCCTGCAACAGTCTGAGTAGC
AATGTTGAAGCCCAACCACTGGTAGATCTCTGTTGTGTAATTTGCACAGG
TGACAATATTGA
Genomic location of T1584  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2112 marker 2112
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)