SGN Marker solcap_snp_sl_2604

SGN-M21122

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57453)
Chromosome
2
Position
9.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTTGCCCTCAAGAACTTCTGAGGGTGAGGATTGCTGTAGGATCCCTCCA
  
3' flanking region
ACTCATCCTCTCCTGTCAATCATAAAATGCCATGTTCGCGAGGTCCTACC
SNP nucleotide
AT
SNPdb format
GTTTGCCCTCAAGAACTTCTGAGGGTGAGGATTGCTGTAGGATCCCTCCA[A/T]
ACTCATCCTCTCCTGTCAATCATAAAATGCCATGTTCGCGAGGTCCTACC
  
Genomic location of solcap_snp_sl_2604  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21122 marker 21122
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)