SGN Marker T1585

SGN-M2113
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBF01TH
Arabidopsis best BAC match: AC006234.3
Arabidopsis position: 2.1200000
Arabidopsis identities: 0.858
Best GenBank protein hit: AAD48975.1
Evalue: 7.4e-67
Identities: 0.893
Description: contains similarity to Pfam family PF00070 - Pyridine nucleotide-disulphide oxidoreductase class-I [Arabidopsis thaliana]
Comment: function unclear
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39694)
Chromosome
2
Position
69.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1585 was used as an overgo probe on plate 11 [well C5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGAAGAATCTTCCGGCAACAGCTC
B sequence
TGCTGAGATGCAACCTGAGCTGTT
AB sequence
TGAAGAATCTTCCGGCAACAGCTCAGGTTG
Marker sequence
GGTGGACATTGAAGAATTTAAATCTGCTCTGTCCCAAGTGGATACTGATA
TGAAGAATCTTCCGGCAACAGCTCAGGTTGCATCTCAGCAAGGTGTCTAC
TTAGCTAAATGCTTTAATCGTATGGAGGAATGTGAAAAAAATCCGGAAGG
TCCTCTTCGGTTTAGAGGAGAAGGCCGCCATCGCTTTCACCCATTCAGGT
ACCGACATTTGGGACAGTTTGCACCTTTGGGAGGAGAGCAAACAGCAGCA
CAACTTCCAGGAGATTGGGTTTCAATTGGTCATAGCAGTCAGTGGCTCTG
GTATTCTGTGTATGCTAGCAAACAAGTCAGTTGGCGTACAAGGGCATTGG
TTGTCTCTGACTGGGTAAGACGGTTCATATTTGGAAGAGACTCAAGCCAG
ATTTAAGGTGTTACGCCCTCGACATTTCATAGGAGCTCCAGTGGATTTAT
CTTGAAATTCCATTAGGCTGTTACCAAAAGTTTCTTGATGTGAATCCTAA
CGGATTTGTT
Genomic location of T1585  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2113 marker 2113
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)