SGN Marker T1587

SGN-M2115
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTBF10TH
Arabidopsis best BAC match: AL078464.1
Arabidopsis position: 4.1530000
Arabidopsis identities: 0.637
Best GenBank protein hit: CAB80994.1
Evalue: 4.6e-25
Identities: 0.645
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39696)
Chromosome
6
Position
43.60 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1587 was used as an overgo probe on plate 1 [well F1]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
AGACTGACAGAGCAACCACAACTG
B sequence
AACCCTAATCCCCTTGCAGTTGTG
AB sequence
AGACTGACAGAGCAACCACAACTGCAAGGG
Marker sequence
GGTTAAATATTCCGGTTAGACTGACAGAGCAACCACAACTGCAAGGGGAT
TAGGGTTTCAGATCTCAGCAAAAAACTTGCCGGAAAAATGGCGTTGAGGA
ACTTCTACAAGGAGATAAAGGGATTGAAGGTGAAGGAGGTTCCGGGGTAC
CTAAAGCCGATGCTCTCAGTCGGTTACGCGAAGAATGCTATCAGGAAGGG
TTTGGATAACTACCATGCTAAGTACATCGAAACCAGCTCCGTTGATCCTC
TTCTCCATGTCTGCTTCGGAGGCATGATATTGTCCTATCTCGTCGCCCTT
CCAAATGAGCGACGTCACCTCGAGCATCAACAGCACGGCGGCGGACATTG
ATTGTCCCTCCGATTTTCTAAGATTGATGATACAGTGAAGGACAAACATC
TATCTCTGATGGTTGCTTTTACCCTCTTTTCA
Genomic location of T1587  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2115 marker 2115
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)