SGN Marker T1600

SGN-M2121
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TPTBN31TH
Arabidopsis best BAC match: AL035356.1
Arabidopsis position: 4.1250000
Arabidopsis identities: 0.666
Best GenBank protein hit: CAA03982.1
Evalue: 8.3e-83
Identities: 0.847
Description: glucose-6-phosphate isomerase [Spinacia oleracea]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39699)
Chromosome
4
Position
85.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1600 was used as an overgo probe on plate 8 [well B4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGGTCACTATTGGTTGAGAAGTCC
B sequence
GTTGGGAGCAAGATGAGGACTTCT
AB sequence
GGGTCACTATTGGTTGAGAAGTCCTCATCT
Marker sequence
GATATGGTGGATTTGGAGAAGGGGGCTATTGCAAACCCTGATGAGGGTAG
AATGGTGGGTCACTATTGGTTGAGAAGTCCTCATCTTGCTCCCAACTCAT
TTCTCAGGTTGCAGATTGAGAATACTCTTGAAGCTGTTTGTGAGTTTGCA
AATGATGTCGTCAGTGGTAAGGTCAAGACTCCTTCTGGAGGCCGATTTAC
GCAAATTCTCTCTGTTGGAATTGGTGGTTCAGCTCTTGGACCACAATTTG
TGGCTGAGGCATTGGCACCTGACAACCCTCCTCTGAAGATAAGATTTATC
GACAATACAGATCCTGCAGGCATTGATCATCAAATTGCGCAACTTGGCCC
TGAGCTGGCTTCAACACTTGTTATTGTTATTTCAAAGAGTGGAGGCACTC
CAGAAACCCGAAATGGCTTGCTAGAAGTTCAGAAGGCCTTCCGTGAAGCT
GGCCTGATATTCGCAAAACAGGGTGTTGCCATTACACAAGAAAACTCATT
GCTTGACAACACTGCTAGAATTGAGGGTTGGTTGGCC
Genomic location of T1600  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2121 marker 2121
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)