SGN Marker solcap_snp_sl_26783

SGN-M21222

Synonyms  
SGN-U577755_snp91
SGN-U577755_snp91_solcap_snp_sl_26783
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70440)
Chromosome
6
Position
0.27 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57553)
Chromosome
6
Position
0.45 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAAATTCTTTGAATTATTGTTGAGCTTGAGTGAATTCCATATATACGCTT
  
3' flanking region
ATATCTCACGAGTGTTATGGAATCGATCTCCTGGAAGACTTCTTCAACTC
SNP nucleotide
AC
SNPdb format
CAAATTCTTTGAATTATTGTTGAGCTTGAGTGAATTCCATATATACGCTT[A/C]
ATATCTCACGAGTGTTATGGAATCGATCTCCTGGAAGACTTCTTCAACTC
  
Genomic location of solcap_snp_sl_26783  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21222 marker 21222
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)