SGN Marker solcap_snp_sl_26879

SGN-M21240

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71768)
Chromosome
1
Position
107.98 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68122)
Chromosome
1
Position
98.55 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64517)
Chromosome
1
Position
170.49 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57571)
Chromosome
1
Position
85.24 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACCATCTACCCTGAAGAGGAGTTGTTTGATGTTGATAGTCTGTTGGATGA
  
3' flanking region
GATACTTTCATGTCTATAGCATTTGAATAAAGCCTTTTTCCCCCTTGATT
SNP nucleotide
AT
SNPdb format
ACCATCTACCCTGAAGAGGAGTTGTTTGATGTTGATAGTCTGTTGGATGA[A/T]
GATACTTTCATGTCTATAGCATTTGAATAAAGCCTTTTTCCCCCTTGATT
  
Genomic location of solcap_snp_sl_26879  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21240 marker 21240
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)