Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T1606

SGN-M2127
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13.01
Tomato EST read: TPTBN61TH
Arabidopsis best BAC match: Z97340.2
Arabidopsis position: 4.0890000
Arabidopsis identities: 0.705
Best GenBank protein hit: CAA78403.1
Evalue: 2e-123
Identities: 0.967
Description: pre-pro-cysteine proteinase [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39701)
Chromosome
4
Position
125.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1606 was used as an overgo probe on plate 8 [well C4]

Plausible BAC Matches:   P305L18

 Overgo Sequences

A sequence
TCCTCCCGACTAAAGATCTTCCAG
B sequence
CGCCAGTCAAAATCAGCTGGAAGA
AB sequence
TCCTCCCGACTAAAGATCTTCCAGCTGATT
Marker sequence
GCTTTCTCCGACTACGATCCGTTGATCCGGCAAGTTGTATCGGAAAACGA
TGACAACCATATGTTAAACGCCGAGCATCACTCTTCACTTTTTAAGGCTA
AGTTTGGAAAGATCTATGCTTCTCAGGAGGAACATGACCATAGATTGAAG
GTATTCAAGGCTAATCTTCGCCGTGCGAAGCGTCACCAGCTCCTTGACCC
TTCCGCTGAGCACGGTATTACGCAGTTCTCCGATTTGACTCCGTCGGAGT
TTCGCCGGACTTACCTTGGACTTAACAAGCCCCGACCTAATCTTAATGCC
GAGAAAGCTCCAATCCTCCCGACTAAAGATCTTCCAGCTGATTTTGACTG
GCGTGAGAAAGGAGCCGTCACCGATGTTAAAAATCAGGGCTCATGTGGAT
CATGCTGGTCATTCAGTACGACTGGAGCAGTGGAGGGAGCTCACTTTTTG
GCGACCGGAGAGCTTGTGAGCCTCAGTGAACAACAGCTTGTGGATTGTGA
CCATGAGTGTGACCCGGTGGAAAAAAATGATTGTGATGCACGTTGCAATG
GTGGTCTTATGACTACTGCCTTTGAGTATACCCTTAAAGCTGGAGGTCTC
CAACTGGAGAAAGACTATCCTTACACTGGCAGGGATGGCAAATGCCACTT
TGA
Genomic location of T1606  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2127 marker 2127
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)