Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_2713

SGN-M21284

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71793)
Chromosome
11
Position
84.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68138)
Chromosome
11
Position
88.89 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57615)
Chromosome
11
Position
52.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGGCTACGACTAGGACTTCGATATCGACGTCGATTGTCGTAGTGCGAGCT
  
3' flanking region
CGCTGAGGTGAGTACCGGCCGCCGTCACCGTTCCGGTGGCTCCGATGCCT
SNP nucleotide
TC
SNPdb format
CGGCTACGACTAGGACTTCGATATCGACGTCGATTGTCGTAGTGCGAGCT[T/C]
CGCTGAGGTGAGTACCGGCCGCCGTCACCGTTCCGGTGGCTCCGATGCCT
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_2713  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21284 marker 21284
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)