SGN Marker TG348

SGN-M213

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AATGTTAAGTTATCAGAAAAAGAATTGCAGAAGAATCAAACAAGTAATAATTAAACTTCCAAAGAAACAAAAGTTAAGTGAGAATCTCAC
ACCTGCTCCACAAAATTACCAAGTACAGATTGAGCACTCAAAAACCTCTGTATAAAAGTATTTATAGTCTCCGACTGTATTGTACTCGTC
ATTCCAGCAAAAAAGAAAGATCTCAAAAAGGGCAGTGCCCAGTATGAACGTAAAGCATATAAACTGGCAATGTGTTTATTTCCATCCAGA
CGGTAGGTTTCGATCATCTCATTCCATCCCACTTCGTATTCCTCAATCGAATGTAAATTGTAGAGGCGATAGAACTCAGCCTTCCAATTA
TCATATTGGGATCCAAGAAGTGTCGAAAACCATTCTGAAAACCTCGAAGTTATATTCCAAATGCAAAATGCATGTTTTACTCTTGGCATT
Reverse sequence
CTAGTTGGAAAATCTCTTGCTTGATAAATTATTATTCATTTGTTGGCTTGAGCTTTATAATTTGCTCCCAATGACGATTCTTCACCTTGG
CTTTGTAATCTTTCATTGAATTTCCTCTTTTCTGTTTTATGATACGAAAACTCAGTACTTATATCTTTTTACCAATTATCCCCTCTCCTA
ATCATCTTTTGTTTGTACATATGTTTGTTACGGGTATAAGGTCTAGCTAGCCATCTCAGTTCCATTCTGGTATGCATAAGCTACAAGCTT
AGCTGTAACAATTGCAGATATCTTTGAGATGCATCTTTCTATCCATAGCTTGCAATTCCTGTGGTTCCATGCTAATACGAAATCCCTTTG
TTTTGCTTTGTTTCTCTAAAATTTGTGCTAGACATTCTTGGGCTTCATGAATGGCAAGACTCCAGGAACCATTTTGACTGATCAAAACTT
GTGGCTCAAAGAAGCCATTGCCACTG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1547391.8e-3477 (17.1% of RFLP seq)+
Mapped locations  
Map: Tomato QTL map   
Map version
137 (location: 53888)
Chromosome
9
Position
45.30 cM
Confidence
uncalculated
Protocol
RFLP

Color_a_a9_1Dry_matter_weight_dmw9_1Soluble_solid_content_ssc9_1Titratable_acidity_ta9_1 Color_b_b9_1 Color_L_L9_1Elasticity_ela9_1 3_Methylthio_propanal_content_mta9_1 3_Methylthio_propanal_content_mta9_2 2_Methylbut_2_enal_content_bea9_1 Orthomethoxy_phenol_content_myp9_1 Eugenol_content_eug9_1
Tomato QTL map

Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53540)
Chromosome
9
Position
50.82 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50374)
Chromosome
9
Position
62.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48308)
Chromosome
9
Position
62.86 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42443)
Chromosome
9
Position
70.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40862)
Chromosome
9
Position
77.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36580
Forward primer (5'-3')
CTCACACCTGCTCCACAAAA
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
ACATGCATTTTGCATTTGGA
Digested band sizes (using AluI)
Solanum lycopersicum TA209
280
Solanum pennellii TA56
400
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40005)
Chromosome
9
Position
62.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8604)
Chromosome
9
Position
75.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8603)
Chromosome
9
Position
69.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Other PCR data 
PCR data   Exp. ID 14137
Forward primer (5'-3')
GAATCTCACACCTGCTCCAC
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CGGGTATAAGGTCTAGCTAGC
Enzymes
  
Accessions and product sizes
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
TG348 was used as an overgo probe on plate 15 [well E4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCAGACGGTAGGTTTCGATCATC
B sequence
AAGTGGGATGGAATGAGATGATCG
AB sequence
TCCAGACGGTAGGTTTCGATCATCTCATTC
Marker sequence
AATGTTAAGTTATCAGAAAAAGAATTGCAGAAGAATCAAACAAGTAATAA
TTAAACTTCCAAAGAAACAAAAGTTAAGTGAGAATCTCACACCTGCTCCA
CAAAATTACCAAGTACAGATTGAGCACTCAAAAACCTCTGTATAAAAGTA
TTTATAGTCTCCGACTGTATTGTACTCGTCATTCCAGCAAAAAAGAAAGA
TCTCAAAAAGGGCAGTGCCCAGTATGAACGTAAAGCATATAAACTGGCAA
TGTGTTTATTTCCATCCAGACGGTAGGTTTCGATCATCTCATTCCATCCC
ACTTCGTATTCCTCAATCGAATGTAAATTGTAGAGGCGATAGAACTCAGC
CTTCCAATTATCATATTGGGATCCAAGAAGTGTCGAAAACCATTCTGAAA
ACCTCGAAGTTATATTCCAAATGCAAAATGCATGTTTTACTCTTGGCATT
Genomic location of TG348  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D213 marker 213
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)