SGN Marker solcap_snp_sl_280

SGN-M21345

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71829)
Chromosome
5
Position
82.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68156)
Chromosome
5
Position
85.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64547)
Chromosome
5
Position
140.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57676)
Chromosome
5
Position
63.74 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTCTACGTCGGCGACGGCGTCTGCTTCGGCATCTGTCGTATCGAAATGGA
  
3' flanking region
GGCGAGGATGAAGGGGATGACGTGGAAGGAATGGATTGAGCTATTTTTTC
SNP nucleotide
AG
SNPdb format
GTCTACGTCGGCGACGGCGTCTGCTTCGGCATCTGTCGTATCGAAATGGA[A/G]
GGCGAGGATGAAGGGGATGACGTGGAAGGAATGGATTGAGCTATTTTTTC
  
Genomic location of solcap_snp_sl_280  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21345 marker 21345
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)