SGN Marker T1617

SGN-M2138
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TRZAA16TH
Arabidopsis best BAC match: AC005896.2
Arabidopsis position: 2.2040000
Arabidopsis identities: 0.693
Best GenBank protein hit: AAC98072.1
Evalue: 3.3e-94
Identities: 0.662
Description: nodulin-like protein [Arabidopsis thaliana]
Comment: function unclear
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49463)
Chromosome
9
Position
3.74 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47397)
Chromosome
9
Position
39.83 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39707)
Chromosome
9
Position
39.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1617 was used as an overgo probe on plate 14 [well G10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGCAACGTTTGCAGCTGCAATGTG
B sequence
GGCAGGAAGAATGTTGCACATTGC
AB sequence
AGCAACGTTTGCAGCTGCAATGTGCAACAT
Marker sequence
GGTGAACTCTACAACAGAGCCAAACCCTTTCTTGCAGTCATTTTTCTCCA
ATTTGGGCTAGCAGGCATGGATATTCTCACCAAAGTGGCCTTGAATGAAG
GAATGAGTAACTATGTATTTGTTGTGTACCGCCATGCAGTTGCCACTTTG
GTTATTGCTCCTTTTGCAATAATTCTAGACAAGAAAGTAAGACCAAAGAT
GACCCCCTCAATATTTGCTAAGTTGGTACTTCTTAGCTTACTGGAGCCTG
TCATCGACCAGAATCTCTACTCTATTGGCCTGAAATACACAACAGCAACG
TTTGCAGCTGCAATGTGCAACATTCTTCCTGCCATTACTTTTATAATGGC
CTGGATATTCAGGCTTGAGAAGGTGAAGCTTACAAGCATCCGCAGCCAAG
CCAAAATAGTTGGGACTGTTGCCACAGTGGCAGGAGCCATGATCATGACA
CTGGTACGAGGTCCAATAGTTGAACTATTTTGGACAACAGGAAATGCCGG
TCATAACTCTCAAAGTGGTGGGTTAAATCTAAGCCATGCTATCAAAGGTT
CCATCATGATAACAATTGGGTGCTTCAGTTGGGCTGCATTCATGATTTTG
CAGGCAATCACACTGCGGACTTATCCCGCTGAGCTCTCGCTCACTGCTTG
GATATGCTNGTTGGGAACAACTGAGGGAGCCATAGTAGCAATGGTAATGG
AGAGAGGAAAACCTGCAGTGTGGGCCATAAACTGGGACTCTAATTTCTTT
GCACTGTATACAGTGGGAATATTCTG
Genomic location of T1617  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2138 marker 2138
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)