SGN Marker TG349

SGN-M214

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1400
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TAGGTCAGTACTATTTCTTGAGAAACCCCACACACCTGCTGAATTTTTTTTTTATTGTAGAATGGTTGAAATATTGAAATGGATTCACAA
GAATTTGATTTGTTGGTAAACACAGATAGGAAATCGAGTTAATTGTACAGTCTGTGAAGATTTGGGGAAAAAAATGTTCTGTTTACATGA
TTGCCCTTTGTTAATCTGTTGGTTTTTCTTTACTTTGGTTATAATAATCCTCTTTTGTTTATTGGGGTTTTTGATTGTTTGATTGGAGTG
ATTGATTCTCCAGAAAGGTCAACGTGTGGGGTGGGGGATTTCGGGGGTNGGGTTTGGTTGATGACCTANAATTGGGAATTGGGGTTCTTG
ACTTTTGTTAGTGGGGCTATTGCTATTGAATTTTTCTGTATGGTACTAGTTTGGTGGATTCTTACTGGATTTGTTTATTGGGGATTACTG
ATTGAAGTAGCT
Reverse sequence
CAGCTATATATGAGAAGTCTAAGCAGGTTTTCTGTTGAAAGTGAAACAAAAGTAGAATGGTAAGTATTTTCTTGCCTCACTTTGAAGAGC
ACAAGACCATCACCCAAGCTCAAAAGCAAAGAAGGAAAAATCAGGAAGGAAGCAAGAACAATCATAACCAGTCAACCTTGGTCTAAGGAC
AACCAAGATTTGTGTGATATGATGTAAGCTCAAAATGGCAAAAACACAAACACAATTCAATAAGACGACGCATATATTGGCTGTCCACAA
CTTCCCAGAAACTAAACTATACAAAATTATTTATTGAATTTTCAATATTATTGTCATGACCTTTAAAATCTCAAAACTCATTCAATTACT
CCACTTATATCAGGGACTATTTGATGATCCATTTACCAAGGCATTACCATAAATCTAATAGCCATCCACAACAAGGCAAAGTATAGAACT
AGCTCATAAAACTCCTAATGCTTATCGTTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53541)
Chromosome
8
Position
33.76 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53278)
Chromosome
8
Position
82.06 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_8 MQTL_1_Maturity_8 MQTL_2_Late_blight_8
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50375)
Chromosome
8
Position
54.00 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48309)
Chromosome
8
Position
39.99 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43859)
Chromosome
8
Position
35.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43602)
Chromosome
8
Position
12.30 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43321)
Chromosome
8
Position
31.00 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42444)
Chromosome
8
Position
45.40 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40863)
Chromosome
8
Position
34.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40006)
Chromosome
8
Position
31.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8608)
Chromosome
8
Position
28.20 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8610)
Chromosome
8
Position
29.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8609)
Chromosome
8
Position
30.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8614)
Chromosome
8
Position
36.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Genomic location of TG349  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D214 marker 214
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)