SGN Marker T1624

SGN-M2143
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TRZAA54TH
Arabidopsis best BAC match: AC007651.2
Arabidopsis position: 1.0442000
Arabidopsis identities: 0.780
Best GenBank protein hit: AAD30584.1
Evalue: 7.2e-50
Identities: 0.813
Description: cl|prt_seq No definition line found [Arabidopsis thaliana]
Comment: similarity with prenyltransferases in cyanobacteria but exact function unclear: suggested role is prenylation of plastoquinone.
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49465)
Chromosome
7
Position
62.08 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47399)
Chromosome
7
Position
58.68 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39711)
Chromosome
7
Position
56.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14125
Forward primer (5'-3')
GATGTCTGTGACTTGCCATA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGTTAGCTAGGTACCAGGAC
Enzymes
  
Accessions and product sizes
Approximate temperature
64°C
  
Overgo hybridization and physical mapping 
T1624 was used as an overgo probe on plate 8 [well A11]

Plausible BAC Matches:   P022P08,   P317O12

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGGGCGTATTTCAACTAAGGCTTC
B sequence
TGCCAACCCAGTAAGTGAAGCCTT
AB sequence
TGGGCGTATTTCAACTAAGGCTTCACTTAC
Marker sequence
GGAGAGAGAGAGAGAGAACTAGTCTCGAGTTTTCTGTTCTTTTTTGCCTA
TTGGGGTGTCGAAAAAAGCAATCTTGAAGCATTGCAAGGCAAAAAATTTG
GTGATTTAGCTAAGTGGGTGTTACAAAGATGATGTCTGTGACTTGCCATA
ATCTTGAAATTGGGAGAACCCCATTGGAGTCTTTGGCTTGTGGCTGTTCT
TTTTCAAAGGGTGTTTTGAGAAATGTAAGTAGAAGATTCAGTGGGAAGAA
GTTGTTGTCTTGCAGACAAGAATTTGGGCGTATTTCAACTAAGGCTTCAC
TTACTGGGTTGGCACCAGTTTTGGATTTGAATAAGTCAGAAAAACCTATT
TCATTGACTAATGTTTTTGAAGTGGTTGCGGATGACCTACTTACGTTAAA
CAAGAACTTGCATAATATTGTTGGTGCAGAGAACCCAGTTTTAATGTCTG
CAGCTGAGCAGATTTTTGGTGCTGGTGGCAAAAGGGTGAGACCTGCTTTA
GTGTTCCTAGTGTCAAGGGCCACAGCAGAAATGTCTGGCTTAAAGGAACT
CACCACAAATCACAGAAGGTTAGCTGAAATCATTGAAATGATCCATACTG
CAAGCTTGATACATGATGACGTGTTAGATGAAAGTGACACACGAAGAGGA
AAGGAGACTATTCACCAATTATATGGTACTAGAGTGGCAGTACTGGCTGG
TGA
Genomic location of T1624  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2143 marker 2143
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)