SGN Marker T1625

SGN-M2144
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TRZAA66TH
Arabidopsis best BAC match: AL030978.1
Arabidopsis position: 4.1390000
Arabidopsis identities: 0.868
Best GenBank protein hit: BAA97523.1
Evalue: 1.4e-92
Identities: 0.879
Description: "1,4-benzoquinone reductase-like; Trp repressor binding"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39712)
Chromosome
2
Position
72.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1625 was used as an overgo probe on plate 12 [well E5]

Plausible BAC Matches:   P323A14

 Overgo Sequences

A sequence
CAGTTGAAGGCGTAGAAGCCAAAC
B sequence
TCTGGTACCTGCCATAGTTTGGCT
AB sequence
CAGTTGAAGGCGTAGAAGCCAAACTATGGC
Marker sequence
GCTCTTTCTTTTCTATTCTATTCCAACAACAACTCATTCATCCACCTACT
ACTTTCCCTTTCAAATGGCAACCAAAGTCTACATTGTTTACTACTCCATG
TATGGACATGTTGAGAAGCTAGCACAAGAGATAAAGAAAGGAGCCGCATC
AGTTGAAGGCGTAGAAGCCAAACTATGGCAGGTACCAGAAACTCTTTCAG
AAGAGGTTCTTGGAAAGATGGGTGGACCAGCAAAAGGCGATGCACCAATT
ATCACACCCAATGACCTTGCTGAAGCTGATGGCTTTGTGTTTGGATTCCC
AACAAGATTTGGGATGATGGCTGCTCAGTTCAAGGCATTTCTTGATGCCA
CTGGTGGTCTCTGGAGAACTCAGCAGCTTGCAGGCAAGCCAGCGGGCCTT
TTCTACAGTACTGGCTCTCAAGGAGGTGGCCAAGAGACTACTGCGTTGAC
TGCAATTACTCAGCTTGTTCACCATGGAATGATCTTTGTCCCGATTGGTT
ACACATTTGGTGCTGGCATGTTCGAGATGGAGAAGATTAAAGGTGGAAGT
CCTTACGGTGCAGGAACTTTTGCTGGAGATGGCTCTAGACAGCCAACAGA
TCTTGAACTGGAGCAAGCTTTCCACCAGGGAAAACACATTGCTACCATCG
CAAAGAAGCTCA
Genomic location of T1625  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2144 marker 2144
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)