SGN Marker T1630

SGN-M2148
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TRZAA85TH
Arabidopsis best BAC match: AC021198.2
Arabidopsis position: 1.0765000
Arabidopsis identities: 0.720
Best GenBank protein hit: AAC97493.1
Evalue: 8e-124
Identities: 0.957
Description: annexin p35 [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39715)
Chromosome
4
Position
62.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14104
Forward primer (5'-3')
CTTTTAAAGGATGGGGCACA
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GAAGGCGAAAACAAAACACAA
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 2100
Solanum lycopersicum LA925: 2100
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
T1630 was used as an overgo probe on plate 7 [well A11]

Plausible BAC Matches:   P077O05,   P103M19,   P101N23,   P151N18,   P164M15,   P166O19,   P072I19

 Overgo Sequences

A sequence
GATTTTCAGCGTGTGGTGCTTCTC
B sequence
CAGGACTCAAAGTCCAGAGAAGCA
AB sequence
GATTTTCAGCGTGTGGTGCTTCTCTGGACT
Marker sequence
GATAATTCAAGAACACACAGCACATTCTCAAGAAAGGGAAAAAAAATGTC
TAGTCTTAAAGTTCCAGCATCAGTTCCAGATCCTTATGAAGATGCTGAGC
AACTCAAAAAAGCTTTTAAAGGATGGGGCACAAATGAGGAACTTATTATT
CAGATTCTGGCTCATAGGAATGCAGCACAACGCAAGTTAATCCGAGATTC
TTATGCTGCTGCTTATGGAGAGGATCTTCTCAAGGACTTGGATTCTGAAC
TGACAAGTGATTTTCAGCGTGTGGTGCTTCTCTGGACTTTGAGTCCTGCT
GAGCGCGACGCCTACTTGGTTAATGAGGCTACCAAACGTCTGACTGCTAG
CAATTGGGTTATCATGGAAATTGCTTGTACCAGGTCTTCTGATGATCTTT
TTAAGGCGAGGCAGGCCTACCATGCTCGATACAAGAAATCACTTGAAGAA
GATGTTGCTTATCATACAAGTGGGGATTTCCGTAAGCTTTTGGTTCCTCT
TATAACTGCATTCAGATATGAAGGAGATGAGGTGAACATGACATTAGCAA
GAAAGGAAGCAAATATACTGCATGAGAAGATCTCTGACAAGGCTTACAAT
GACGAGGAGATCATCCGAATCATTTCTACTAGGAGTAAAGCACAGCTGAG
TGCTACGTTCAACCACTACAATGATCACCATGGCCATGAAATCATCAAAG
ATCTGGAAGCTGATGATGACGATGAGTACCTGAAACTACTCAGAGC
Genomic location of T1630  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2148 marker 2148
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)