SGN Marker TG560

SGN-M215

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
TGAAGAAGAGATGCTGGGGATTGAATATCCCTATGTTCCAAGTGGTACAACCTCCTTAATTCATTTTCTTCGATACTTAAGAGTAATTTC
CAATACATCTGCCATTGTTATATGATATGTGCCTCAAACTCCATTGTCATTAATTGGTTTATGAAGAGAGTTGGTTTGACCAAAAGTTGA
GGAAATTGGAAAACCTATTTGGAATTGACAACGTGAAAAATCATGGTTGAAATTGTGGTTTGAGATTTTGTTTTTTTGTATTTTTAGATA
CTTAGAAAATGATCGAGAGTGATACTTGTATTGATCATCATTGATTGTACACTGAGTTCTGTGATTTGTTAACGTTTTTGATAAGTTGAT
GACTGATGTTCGTTGGGATTGTTATTTTGAAGTTGTTAAATATTGAAGCTACTTGGGGATGTTTTGACCTATTTTAGAGTGTAGTTTTGT
GAGTTCAACTTTTACAGGAAAAAAGTTC
Reverse sequence
ATTCATGAAACTTGCTTGTGGACAGAAGCATTTGTTGATGTTCGCGATTTTATCAGTCAGGAAATCAGGAGTATATATTCAAGTGGAAGG
ATCACATCACTGAAAGAGCTTGAAGTAGTGGATACAAGTGTGAAGAAGCTCTATCCACTCATACAGGATGGAGTAGATCCTAATGAAGCT
GAGCAGTTGCAGCTCTTAACTTCAAATCTGGCTGAAAAGGCGGAAAAACTTTCAGGAGGACTAGATCTGCTAGCAAAGGAAGCAGATAGA
TTCTTCCATATCCTTTTAACTGGACGCGATTCTCTGCTCTGTAACCTTAGAATTGATAATACTGTTTCTAACCCGGCGGAAGTGAACAAC
AATGTAGAAAGGAAAGAGGTGAGGTGAACCTTAGATATAAGAGGATTTGTTCTGTGCATACAGGGTGGTGGTGTGTGTTTCAGTTTTAAG
GTTGAATTTCATGTGCT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1439994.1e-23310 (66.4% of RFLP seq)-
SGN-U152049437 (93.6% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53355)
Chromosome
10
Position
45.75 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50409)
Chromosome
10
Position
4.40 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48341)
Chromosome
10
Position
28.19 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40087)
Chromosome
10
Position
30.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8615)
Chromosome
10
Position
31.10 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG560 was used as an overgo probe on plate 16 [well C3]

Plausible BAC Matches:   P232J20,   P041K23

 Overgo Sequences

A sequence
CCCTATGTTCCAAGTGGTACAACC
B sequence
GAAAATGAATTAAGGAGGTTGTAC
AB sequence
CCCTATGTTCCAAGTGGTACAACCTCCTTA
Marker sequence
TGAAGAAGAGATGCTGGGGATTGAATATCCCTATGTTCCAAGTGGTACAA
CCTCCTTAATTCATTTTCTTCGATACTTAAGAGTAATTTCCAATACATCT
GCCATTGTTATATGATATGTGCCTCAAACTCCATTGTCATTAATTGGTTT
ATGAAGAGAGTTGGTTTGACCAAAAGTTGAGGAAATTGGAAAACCTATTT
GGAATTGACAACGTGAAAAATCATGGTTGAAATTGTGGTTTGAGATTTTG
TTTTTTTGTATTTTTAGATACTTAGAAAATGATCGAGAGTGATACTTGTA
TTGATCATCATTGATTGTACACTGAGTTCTGTGATTTGTTAACGTTTTTG
ATAAGTTGATGACTGATGTTCGTTGGGATTGTTATTTTGAAGTTGTTAAA
TATTGAAGCTACTTGGGGATGTTTTGACCTATTTTAGAGTGTAGTTTTGT
GAGTTCAACTTTTACAGGAAAAAAGTTC
Genomic location of TG560  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D215 marker 215
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)