SGN Marker solcap_snp_sl_29479

SGN-M21531

Synonyms  
SGN-U564967_snp1010
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71928)
Chromosome
5
Position
31.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57862)
Chromosome
5
Position
4.13 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGTTTGACATGATCCATTCCTGCCGATAGATTTGTTAGCCTACCAGTCG
  
3' flanking region
AAATTGAGTTGGAAACTTGTTGACTCCCAACATATTAATCGTTCGAGTAG
SNP nucleotide
AT
SNPdb format
GAGTTTGACATGATCCATTCCTGCCGATAGATTTGTTAGCCTACCAGTCG[A/T]
AAATTGAGTTGGAAACTTGTTGACTCCCAACATATTAATCGTTCGAGTAG
  
Genomic location of solcap_snp_sl_29479  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21531 marker 21531
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)