Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_29483

SGN-M21534

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71931)
Chromosome
5
Position
29.74 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57865)
Chromosome
5
Position
4.04 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACTCACTCTTAAACAATTATTCACACTACCATCAAAGTTACGTAATTAAA
  
3' flanking region
ATTTCGAGTTCGAATCATCAAGTGCTATAATTAAAGATTTTGAATTCGAC
SNP nucleotide
AG
SNPdb format
ACTCACTCTTAAACAATTATTCACACTACCATCAAAGTTACGTAATTAAA[A/G]
ATTTCGAGTTCGAATCATCAAGTGCTATAATTAAAGATTTTGAATTCGAC
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_29483  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21534 marker 21534
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)