SGN Marker T1639

SGN-M2154
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TRZAU67TH
Arabidopsis best BAC match: AL049751.1
Arabidopsis position: 4.0800000
Arabidopsis identities: 0.609
Best GenBank protein hit: AAF05857.1
Evalue: 5.2e-67
Identities: 0.636
Description: putative short-chain type dehydrogenase/reductase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39718)
Chromosome
6
Position
57.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1639 was used as an overgo probe on plate 5 [well F5]

Plausible BAC Matches:   P052N09,   P006P14,   P309H13,   P119G11,   P270O04,   P128E05,   P052F03

 Overgo Sequences

A sequence
AGCAATGGCAGCAGAAAACGTAGC
B sequence
TGGGAAGGTTGATTGGGCTACGTT
AB sequence
AGCAATGGCAGCAGAAAACGTAGCCCAATC
Marker sequence
GATAGCAATTAGTGTGTTTTCTCTTCAGCAATGGCAGCAGAAAACGTAGC
CCAATCAACCTTCCCACTCCAAGATCGTGTGGCCATTGTTACCGGTTCTT
CTCGCGGAATCGGCAAAGCAATTGCACTTCATTTGGCCTCACTTGGTGCT
AAACTCGTCATCAACTATTCCTCCAACTCCACTCAAGCTGACGACGTCGT
ATCCCAGATCAATTCCACCTCCGGTTACCCACGTGCCATTGCGGTCAAGG
CCAATATCTCAGATCCAGATCAAGTGAAATCCCTCTTTGACGCTGCTGAA
TCGGCTTTTCAATCGCCGGTCAACATCCTGGTAAACTCCGCCGGGGTACT
CGACGGAAAATACCCGTCAATCCTAAACACAACCCTAGAGGATTTCGACA
GGACTTTTGATGTGAACGCTCGTGGAGCTTTCGTATGCTGCAAGGAAGGT
GCTAAGAGAATCAAACACCGTGGAGGAGGGAGGATTATATGCTTATCGAC
GTCCTTAGCAGCGGCGTTTAGACCTGGATACGGAGCGTACATCGCTTCAA
AAGCGGCCGTGGAAGCAATGGTGAAGATACTGGCGAAGGAACTGAAAGGG
ACAGGAATAACGGTGAATTGTGTGG
Genomic location of T1639  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2154 marker 2154
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)