SGN Marker solcap_snp_sl_29549

SGN-M21559

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71949)
Chromosome
2
Position
36.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68231)
Chromosome
2
Position
53.10 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64615)
Chromosome
2
Position
73.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57890)
Chromosome
2
Position
37.12 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AATACTTACCAACTAAAGACTTCAAGGCTATGGAGATTAAGGTAGATAAT
  
3' flanking region
AGATACCCCGGAATCTTGATGACGAGAAAGTTCCTCTGCTTGAAAGCTCA
SNP nucleotide
CG
SNPdb format
AATACTTACCAACTAAAGACTTCAAGGCTATGGAGATTAAGGTAGATAAT[C/G]
AGATACCCCGGAATCTTGATGACGAGAAAGTTCCTCTGCTTGAAAGCTCA
  
Genomic location of solcap_snp_sl_29549  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21559 marker 21559
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)