SGN Marker T1641

SGN-M2156
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07.03
Tomato EST read: TRZAU83TH
Arabidopsis best BAC match: AC006260.3
Arabidopsis position: 2.2030000
Arabidopsis identities: 0.758
Best GenBank protein hit: AAD18146.1
Evalue: 1.8e-46
Identities: 0.728
Description: putative peroxidase ATP2a [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49470)
Chromosome
9
Position
1.10 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47404)
Chromosome
9
Position
9.19 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 43011)
Chromosome
9
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44011
Forward primer (5'-3')
GTGGCTGGTTTTGGTTGCTA
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
CCCTAGCGGAAAGAGCAAC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39720)
Chromosome
9
Position
9.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1641 was used as an overgo probe on plate 1 [well E5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GTGCAGATATTGTTGCTCTTTCCG
B sequence
AGAAGACCATCCCTAGCGGAAAGA
AB sequence
GTGCAGATATTGTTGCTCTTTCCGCTAGGG
Marker sequence
CATTCATGAAGTTTCATTGAGTGGGACTACAACTAGAGACCTAAAAGTCC
AACAAAGTGGCTGGTTTTGGTTGCTAATTAATTAGTGCACCAAATTTTCA
AATCCAATATTCCTTTTTCCACTTCAAAGTTCAAACTAGTGCACAATTCC
AAAACCATTTGCTACTATATAAATTGAGCTTTTGGGACATTTCATCAAAT
ATTGGCCAAAGTACAACACTTCATTACACATCAAAGACATGGCCAATTGT
TCAAGATTTCTCTTATTGTTATTACCTCTACTTCTTCACATTCATAATGT
AAAAAGTGAGCTCCAATTAAATTACTACACAAAGAGTTGCCCAAGAGCTG
AAGATATCATCAAAGAACAAGTGGCAACATTGTACCACAAACATGGGAAC
ACAGCAGTTTCTTGGATTAGAAATCTTTTTCATGATTGCATGGTTAAGTC
ATGTGATGCATCACTATATTTGGACACAGCAAATGGGCTAGAATCAGAAA
AAGAATCTCCAAGGAATTTTGGGATGAGGAATTTTAAGTATATTGAGACA
ATTAAACAAGCACTTGAAAAAGAATGTCCAAATACCGTTTCTTGTGCAGA
TATTGTTGCTCTTTCCGCTAGGGATGGTCTTCTTTGGTTAGGA
Genomic location of T1641  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2156 marker 2156
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)