SGN Marker solcap_snp_sl_2960

SGN-M21565

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57896)
Chromosome
11
Position
34.95 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCTTCTCTTTTATTTTTGGTCTGGGAAGCTGAAAATATTGTAATGATAG
  
3' flanking region
CGGAGAAAATACATCTACTTGGAAAACATATTCAGAGTAGGGATAGGGAT
SNP nucleotide
AT
SNPdb format
TTCTTCTCTTTTATTTTTGGTCTGGGAAGCTGAAAATATTGTAATGATAG[A/T]
CGGAGAAAATACATCTACTTGGAAAACATATTCAGAGTAGGGATAGGGAT
  
Genomic location of solcap_snp_sl_2960  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21565 marker 21565
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)