SGN Marker solcap_snp_sl_2974

SGN-M21579

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71964)
Chromosome
11
Position
50.61 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57910)
Chromosome
11
Position
34.44 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGCAGAGGTCCCATCGATGGCAATGGACGCAACAACTTTTCGGAGACTGA
  
3' flanking region
CGGGACATCATCAAGGAGTAAAAAGAGTGTGTCTTTCCATGATTGTATCC
SNP nucleotide
CG
SNPdb format
TGCAGAGGTCCCATCGATGGCAATGGACGCAACAACTTTTCGGAGACTGA[C/G]
CGGGACATCATCAAGGAGTAAAAAGAGTGTGTCTTTCCATGATTGTATCC
  

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43565)
Chromosome
11
Position
42.70 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43209)
Chromosome
11
Position
48.40 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
CAATGGACGCAACAACTTTTCGGAGACTGA
ASPE primers (5'-3')
ACAACTTTTCGGAGACTGAC
ACAACTTTTCGGAGACTGAG
3' flanking region
CGGGACATCATCAAGGAGTAAAAAGAGTGT
SNP nucleotide
CG
SNPdb format
CAATGGACGCAACAACTTTTCGGAGACTGA[C/G]
CGGGACATCATCAAGGAGTAAAAAGAGTGT
  
Genomic location of solcap_snp_sl_2974  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21579 marker 21579
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)