SGN Marker TG279

SGN-M216

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
900
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG279 image not available
Forward sequence
ACCATCTCAACAGACTAGGTCCTCCTTATGCATTGCCTGTAGAATCCGCTGTCGCTTCATCTTTGGAAAATATAGATCATAAGGGGGTAG
GTCCCTTCCGAGGGGGCAAGAATGGTGGCCATGGCAAAGGTCGCCGGCTGGCAAATGGGATGATTTCTACTACCTCTAGGAAACTCAGGA
ATCTGGAAAAGTCAAATGAGGGGTCAGATGATGCAATTTCAAACATAGAAGGGCCAGCTCAGTTTTCCAGGCATCCAGTACATGCTGCAC
CAGGAAAAGATCTTGAAACTGGTCTTCAACCTTTAAATCTCAATGACTCTGGCTATGCTACCTCCTTGTTAGATAGAAATTTGCCCATAT
ACATGAACTGCCCCCATTGCATGGAGTTGAAGAGTAAGAATGACCAAACAGATGCGAGATTTGCAGGAACCATTTCACAGCTCCAGAGGA
TCTTTCTGGTTGGAGTCTTACTTCT
Reverse sequence
AAGAGGTGCCAATTTCTACGTTATGTTATTTGCAAGTAACCCACTTCTCTAGTTACCCACAATTTCAATGTGTTAGCTAACATGCCACAT
TTCACTGTATTTCACTAGAAATAGGTCCTTTAAACAGAAAATATTAAATAGTATCCAACTATAAGTTGAATAGAGAAGACCAACAGATCT
CTAATATCTTATATTTCCTTTAAATTTCCTCATACGCAGCCTTGGCCATGAATAGACTGCTGATATGTCCACGAAGTCGGTGAAAATAAG
CAAATGAATTTACAAAAACAGGGTAAGTGCAGATATCTTAAAACACATGTTTACATTATGAGTTGTCTCTTAATCCACTCATAATTGGTT
TAGGCACTCAACACATAAAACCATATCATCTAAGCCTGTTCATTAGATTAATAGAAACAATGGATGAGATAAGCACTTAAAAATGACATC
ACATAAAAAAGATACTTCTTTATGAGGTCATAAAGATTCAGGGAAGTTGAGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1675157e-179331 (69.7% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53532)
Chromosome
6
Position
57.65 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39974)
Chromosome
6
Position
80.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8619)
Chromosome
6
Position
96.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8620)
Chromosome
6
Position
69.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8624)
Chromosome
6
Position
73.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 35627
Forward primer (5'-3')
GTAGAATCCGCTGTCGCTTC
Digested band sizes (using DraI)
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 300+450
Mg+2 concentration
3mM
Reverse primer (5'-3')
TATGTCCACGAAGTCGGTGA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 83
Forward primer (5'-3')
Unknown
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 300+450
Solanum pennellii LA716: 750
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG279 was used as an overgo probe on plate 4 [well A5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GACTAGGTCCTCCTTATGCATTGC
B sequence
ACAGCGGATTCTACAGGCAATGCA
AB sequence
GACTAGGTCCTCCTTATGCATTGCCTGTAG
Marker sequence
ACCATCTCAACAGACTAGGTCCTCCTTATGCATTGCCTGTAGAATCCGCT
GTCGCTTCATCTTTGGAAAATATAGATCATAAGGGGGTAGGTCCCTTCCG
AGGGGGCAAGAATGGTGGCCATGGCAAAGGTCGCCGGCTGGCAAATGGGA
TGATTTCTACTACCTCTAGGAAACTCAGGAATCTGGAAAAGTCAAATGAG
GGGTCAGATGATGCAATTTCAAACATAGAAGGGCCAGCTCAGTTTTCCAG
GCATCCAGTACATGCTGCACCAGGAAAAGATCTTGAAACTGGTCTTCAAC
CTTTAAATCTCAATGACTCTGGCTATGCTACCTCCTTGTTAGATAGAAAT
TTGCCCATATACATGAACTGCCCCCATTGCATGGAGTTGAAGAGTAAGAA
TGACCAAACAGATGCGAGATTTGCAGGAACCATTTCACAGCTCCAGAGGA
TCTTTCTGGTTGGAGTCTTACTTCT
Genomic location of TG279  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D216 marker 216
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)