SGN Marker T1649

SGN-M2160
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: None
Arabidopsis best BAC match: AP000371.1
Arabidopsis position: 3.0920000
Arabidopsis identities: 0.600
Best GenBank protein hit: AAD37373.1
Evalue: 1.5e-40
Identities: 0.666
Description: NADPH:quinone oxidoreductase [Arabidopsis thaliana]
Comment: Experimental evidence lacking.
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39722)
Chromosome
1
Position
91.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1649 was used as an overgo probe on plate 9 [well D5]

Plausible BAC Matches:   P077N09,   P140O23

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGCCGTTTCTGAACACGGATCTTG
B sequence
TAAGTCCCGTCCACTTCAAGATCC
AB sequence
TGCCGTTTCTGAACACGGATCTTGAAGTGG
Marker sequence
AATCAAAGTAGCTGGGCTTTGCGGTTCCCTCCGTAAAGGTTCCTACAATC
ATGGTCTCCTCAATGCCGCGATGGAGATATGCAAGGATTCTATAACGGGA
ATGGAGATCGAGTACGTCGATATATCGCCGCTGCCGTTTCTGAACACGGA
TCTTGAAGTGGACGGGACTTATCCCCCGGCTGTCGAGGCTTTTCGTAAGA
AAATTGAAGAAGCTGATTGCTTCCTTTTTGCTTCTCCAGAGTACAATTAC
TCCATCACAGGACCGTTGAAGAAAGCAATTGATTGGGCCTCTCGACCTCC
AAATGTTTGGGCTGATCAAGCAACAGCAATGGTGA
Genomic location of T1649  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2160 marker 2160
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)