SGN Marker solcap_snp_sl_29914

SGN-M21605

Synonyms  
SGN-U572314_snp1007
SGN-U572314_snp1007_solcap_snp_sl_29914
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70405)
Chromosome
2
Position
63.51 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66936)
Chromosome
2
Position
83.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63418)
Chromosome
2
Position
118.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57936)
Chromosome
2
Position
44.65 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCCCTTTCTTTACAAGGGTGTTTGCAGTGTATAATTGGACAGCAGGTGC
  
3' flanking region
GTCGTTTGTAAACTCATCACTCTTCCTGACTTATTATCGTGAACTGTTGC
SNP nucleotide
AG
SNPdb format
TTCCCTTTCTTTACAAGGGTGTTTGCAGTGTATAATTGGACAGCAGGTGC[A/G]
GTCGTTTGTAAACTCATCACTCTTCCTGACTTATTATCGTGAACTGTTGC
  
Genomic location of solcap_snp_sl_29914  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21605 marker 21605
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)