Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_30035

SGN-M21642

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72002)
Chromosome
3
Position
45.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68263)
Chromosome
3
Position
44.12 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64648)
Chromosome
3
Position
47.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57973)
Chromosome
3
Position
13.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATCCAAGATATCTTAGATGCTCCACTGCCCAGAAAAAAGAAAATAAAAGG
  
3' flanking region
AAAAAAATGTACATGTTATTAGAAGATCCTTTTCGAACCAACTAAGCTGC
SNP nucleotide
AG
SNPdb format
ATCCAAGATATCTTAGATGCTCCACTGCCCAGAAAAAAGAAAATAAAAGG[A/G]
AAAAAAATGTACATGTTATTAGAAGATCCTTTTCGAACCAACTAAGCTGC
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_30035  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21642 marker 21642
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)