SGN Marker T1654

SGN-M2165
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBC22TH
Arabidopsis best BAC match: AC068667.4
Arabidopsis position: 1.0617000
Arabidopsis identities: 0.716
Best GenBank protein hit: AAG12626.1
Evalue: 1.9e-58
Identities: 0.772
Description: "plasma membrane associated protein, putative; [Arabidopsis thaliana]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49473)
Chromosome
2
Position
35.37 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47407)
Chromosome
2
Position
53.36 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39725)
Chromosome
2
Position
46.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1654 was used as an overgo probe on plate 11 [well A9]

Plausible BAC Matches:   P096K18,   P118I17,   P079E04,   P096B03,   P303J10,   P131H24,   P217K16,   P072A04,   P277C14,   P110B11,   P227D21,   P330E02,   P002P16

 Non-Plausible BAC matches

P055F13,   P227E20,   P134A15,   P168N18

 Overgo Sequences

A sequence
TGATAGCAGGTGTGGTTGGAGTTG
B sequence
CCAGAGAGAACAGATGCAACTCCA
AB sequence
TGATAGCAGGTGTGGTTGGAGTTGCATCTG
Marker sequence
CTTATTCAGTTTTCATCAAAAAGAGGTTTCAAGCCTTACTATCATTATCA
TTTTCAAGAACCAAGAATGGCTAGTGAGCAGATGAAACCTGTTGCATCTT
TGCTTTTGGTCCTTAATTTCTGCATGTATGTTGTTGTTTTAGGTATTGGT
GGTTGGGCTATGAACTTTGCCATTGATAATGGTTTTGTCATTGGTCCAGG
AATGAATCTTCCAGCACATTTCTCACCAATTTACTTCCCAATTGGAAATG
CTGCCACTGGATTCTTTGTTGTATTTGCTTTGATAGCAGGTGTGGTTGGA
GTTGCATCTGTTCTCTCTGGACTTAACCACATTCGCCATTGGAACATCGA
TAGCTTACCATCTGCTGCTTCTGCTGCTACAATAGCCTGGAGTCTTACAG
TCCTTGCCATGGGCTNTGCTTGGAAAGAAATTGAACTCAACTACAGGAAT
TCCAAATTGAAAACAATGGAGGCATTCATGATAATTCTATCATTTACTCA
ACTGGTATACATAACTGCCATTCATGGTGCTTCATCAAGG
Genomic location of T1654  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2165 marker 2165
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)