SGN Marker solcap_snp_sl_301

SGN-M21655

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72012)
Chromosome
5
Position
83.08 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 57986)
Chromosome
5
Position
63.82 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGCGAGAGCAGGCTCATATAGACAGAAATCTTTCTCGGAAGCTCACTCCT
  
3' flanking region
ATGAGCTTCGTGAGAAGAAAGAAAAGAAACTCTTTGACGACCCAACTATT
SNP nucleotide
CG
SNPdb format
AGCGAGAGCAGGCTCATATAGACAGAAATCTTTCTCGGAAGCTCACTCCT[C/G]
ATGAGCTTCGTGAGAAGAAAGAAAAGAAACTCTTTGACGACCCAACTATT
  
Genomic location of solcap_snp_sl_301  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21655 marker 21655
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)