SGN Marker T1657

SGN-M2168
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBC36TH
Arabidopsis best BAC match: AC005499.2
Arabidopsis position: 2.2090000
Arabidopsis identities: 0.732
Best GenBank protein hit: AAC67347.1
Evalue: 4.1e-48
Identities: 0.741
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49474)
Chromosome
11
Position
1.36 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47408)
Chromosome
11
Position
18.67 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39726)
Chromosome
11
Position
9.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14150
Forward primer (5'-3')
ACACCCGCTGTTTGTGACTT
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
GGGTGCACTCAGCACTGAAA
Enzymes
  
Accessions and product sizes
Approximate temperature
60°C
  
Overgo hybridization and physical mapping 
T1657 was used as an overgo probe on plate 1 [well E7]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ATGAGACTGCAGCTAACTACCTTG
B sequence
TTCCCTACCTCCCAATCAAGGTAG
AB sequence
ATGAGACTGCAGCTAACTACCTTGATTGGG
Marker sequence
GGAGTTACCTACTTTACAGTGTACAGTTTCAATTCTCACTAATTATGAGA
CTGCAGCTAACTACCTTGATTGGGAGGTAGGGAAGCATGGGATAATTATT
GAATTTACTGACCCTAACTATAACACAAGAAGAAACGCCACGTACCTACC
TGAGGTGGCTGCTCATGAAGGGTGGACCGTTATAGAAGCAATTGACTCAC
TGATACGCAAAGCAGGTTATAATGGACCTATAACAGAATCATTGAGGAAG
CAAATCCATCTAACTCGATACCAGAGCACATTATTTACTATGCAGTACAG
TGAATATGTGGATCATGTTAAAGAAACCCGAGGTCTCGATCCAACTATTA
ATGGTGTGAAACCTTGAACAACGTATGGATTGTTCGGAGGAATCTT
Genomic location of T1657  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2168 marker 2168
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)