SGN Marker T1660

SGN-M2171
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.01
Tomato EST read: None
Arabidopsis best BAC match: AF069299.1
Arabidopsis position: 4.0020000
Arabidopsis identities: 0.895
Best GenBank protein hit: BAA96366.1
Evalue: 1.7e-37
Identities: 0.925
Description: cytoplasmic ribosomal protein S13 [Panax ginseng]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39728)
Chromosome
11
Position
96.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1660 was used as an overgo probe on plate 10 [well E9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGGCTCTTCCTTACAAGAGAACTC
B sequence
TTAAGCCAACTGGGAGGAGTTCTC
AB sequence
CGGCTCTTCCTTACAAGAGAACTCCTCCCA
Marker sequence
CAATTTGAGCAACACAGTTCAGTGAGCTCACTCTAATCTTCGCCTGGGTC
GTATGCACAGTCGCGGTAAGGGTATCTCAACGTCGGCTCTTCCTTACAAG
AGAACTCCTCCCAGTTGGCTTAAGATCTCTGCTCCAGATGTGGAGGACAA
TATCTGCAAGTTTGCGAAAAAAGGACTGACACCTTCACAAATTGGTGTGA
TTCTTCGGGATTCTCATGGAATTGCTCAAGTCAAGAGTGTCACCGGGAGC
AAGATTTTGCGTATCCTCAAAGCTCACGGACTTGCT
Genomic location of T1660  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2171 marker 2171
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)